View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0186_low_21 (Length: 269)
Name: NF0186_low_21
Description: NF0186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0186_low_21 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 28 - 269
Target Start/End: Complemental strand, 54395571 - 54395330
Alignment:
| Q |
28 |
ataatatgaggaatacaataaaggatgagaagattggtgggaagttgagtcatgatgataaggagaagattgagaaggctgtggaagatgctatacagtg |
127 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54395571 |
ataatatgaggaatacaattaaggatgagaagattggtgggaagttgagtcatgaagataaggagaagattgagaaggctgtggaagatgcaatacagtg |
54395472 |
T |
|
| Q |
128 |
gttggaggggaatcaaatggcggaagtggatgagtttgaggataagcagaaggagttggaaggaatttgtaatcctattattgctaagatgtatcaaggt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54395471 |
gttggaggggaatcaaatggcggaagtggatgagtttgaggataagcagaaggagttggaaggaatttgtaatcctattattgctaagatgtatcaaggt |
54395372 |
T |
|
| Q |
228 |
ggtgctggtggagatgtgcctatgggagatggtatgcctggt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54395371 |
ggtgctggtggagatgtgcctatgggagatggtatgcctggt |
54395330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1196 times since January 2019
Visitors: 2246