View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0186_low_26 (Length: 205)

Name: NF0186_low_26
Description: NF0186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0186_low_26
NF0186_low_26
[»] chr3 (1 HSPs)
chr3 (1-101)||(2622319-2622422)


Alignment Details
Target: chr3 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 2622422 - 2622319
Alignment:
1 aggatacggaaatatggtgacatatcat---aatattaagatcagaatagaagtcacacaacataaagatagggaaactatatatgtgattaatgaacag 97  Q
    ||||||||||||||||||||||||||||   ||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
2622422 aggatacggaaatatggtgacatatcatcataatattaaggtcagaatagaagtcacacaacataaagatagggcaactatatatgtgattaatgaacag 2622323  T
98 atac 101  Q
    ||||    
2622322 atac 2622319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 990 times since January 2019
Visitors: 2242