View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0186_low_27 (Length: 204)
Name: NF0186_low_27
Description: NF0186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0186_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 49520786 - 49520889
Alignment:
Q |
1 |
caatctaatattgcctgaactgatgcactctcaggtataccttctggccacattggaatcaccacatacacgacaaacctctctccggcttcaattttgc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49520786 |
caatctaatattgcctgaactgatgcactctcaggtataccttctggccacattggaatcaccacatacacgacaaacctctctccggcttcaattttgc |
49520885 |
T |
 |
Q |
101 |
taat |
104 |
Q |
|
|
|||| |
|
|
T |
49520886 |
taat |
49520889 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 49509640 - 49509742
Alignment:
Q |
1 |
caatctaatattgcctgaactgatgcactctcaggtataccttctggccacattggaatcaccacatacacgacaaacctctctccggcttcaattttgc |
100 |
Q |
|
|
|||||||||||||| |||||||| ||||| ||||||||||||||||||||||||||||| || | ||||| ||| |||||||| |||||||| |||| |
|
|
T |
49509640 |
caatctaatattgcttgaactgaagcactttcaggtataccttctggccacattggaatgacaatgtacacagaaaatctctctccagcttcaatcttgc |
49509739 |
T |
 |
Q |
101 |
taa |
103 |
Q |
|
|
||| |
|
|
T |
49509740 |
taa |
49509742 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University