View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0186_low_5 (Length: 483)
Name: NF0186_low_5
Description: NF0186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0186_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 36 - 402
Target Start/End: Original strand, 12550727 - 12551093
Alignment:
| Q |
36 |
tgatatgaaagaaagtcattattgatctggatagatcgagaaagttatctggattggagcactctgacgtctaagatagtaagtgaccaaagagtgtgag |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12550727 |
tgatatgaaagaaagtcattattgatctggatagaccgagaaagttatctggattggagcactctgacgtataagatagtaagtgaccaaagagtgtgag |
12550826 |
T |
|
| Q |
136 |
gtttacgagttgagaaattgtgtaccttgcattgttgtgagaaggattatttatacaatcctagaaaggagctgttgatgcgtaaagggaggaacgttac |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12550827 |
gtttacgagttgagaaattgtgtaccttgcattgttgtgagaaagagtatttatacaatcctagaaaggagctgttgatgcgtaaagggaggaacgttac |
12550926 |
T |
|
| Q |
236 |
atatgacacccttcattaatggtgtgctcttgcagccgttcaaggtcattgaactcgttgaggcgttacaaatttcaagaatcttatgccaggtggattg |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12550927 |
atatgacacccttcattaatggtgtgctcttgcagccgttcgagggcattgaactcgttgaggcgttacaaatttcaagaatcttatgccaggtggattg |
12551026 |
T |
|
| Q |
336 |
gtctttgggtcaagtgtgctttaaaagagggttgtgacttgtgagttcgcaagagattggaccttag |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12551027 |
gtctttgggtcaagtgtgctttaaaagagggttgtgacttgtgagttcgcaagagattggaccttag |
12551093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 888 times since January 2019
Visitors: 2241