View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0187_low_10 (Length: 258)

Name: NF0187_low_10
Description: NF0187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0187_low_10
NF0187_low_10
[»] chr4 (1 HSPs)
chr4 (71-235)||(49916082-49916242)


Alignment Details
Target: chr4 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 71 - 235
Target Start/End: Complemental strand, 49916242 - 49916082
Alignment:
71 gtgagatgaatggtaaatagtaagtatgctactaatcctactatatactctctccatacaaagtttaagcacaattctttctttattgtaaaagtatatt 170  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    ||||||||||||||||    
49916242 gtgaaatgaatggtaaatagtaagtatgctactaatcctactatatactctctacatacaaagtttaagcacaattcttt----attgtaaaagtatatt 49916147  T
171 tctaatgtggtgtcattctcatctttgctttggccaccaatcaccataagatatatgtaacaggt 235  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
49916146 tctaatgtggtgtcattctcatctttgctttggccaccaatcaccataagataaatgtaacaggt 49916082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University