View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0187_low_10 (Length: 258)
Name: NF0187_low_10
Description: NF0187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0187_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 71 - 235
Target Start/End: Complemental strand, 49916242 - 49916082
Alignment:
| Q |
71 |
gtgagatgaatggtaaatagtaagtatgctactaatcctactatatactctctccatacaaagtttaagcacaattctttctttattgtaaaagtatatt |
170 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49916242 |
gtgaaatgaatggtaaatagtaagtatgctactaatcctactatatactctctacatacaaagtttaagcacaattcttt----attgtaaaagtatatt |
49916147 |
T |
 |
| Q |
171 |
tctaatgtggtgtcattctcatctttgctttggccaccaatcaccataagatatatgtaacaggt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
49916146 |
tctaatgtggtgtcattctcatctttgctttggccaccaatcaccataagataaatgtaacaggt |
49916082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University