View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0187_low_18 (Length: 224)
Name: NF0187_low_18
Description: NF0187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0187_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 30 - 194
Target Start/End: Complemental strand, 49916242 - 49916082
Alignment:
Q |
30 |
gtgagatgaatggtaaatagtaagtatgctactaatcctactatatactctctccatacaaagtttaagcacaattctttctttattgtaaaagtatatt |
129 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
49916242 |
gtgaaatgaatggtaaatagtaagtatgctactaatcctactatatactctctacatacaaagtttaagcacaattcttt----attgtaaaagtatatt |
49916147 |
T |
 |
Q |
130 |
tctaatgtggtgtcattctcatctttgctttggccaccaatcaccataagatatatgtaacaggt |
194 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
49916146 |
tctaatgtggtgtcattctcatctttgctttggccaccaatcaccataagataaatgtaacaggt |
49916082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1088 times since January 2019
Visitors: 2243