View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0187_low_19 (Length: 220)

Name: NF0187_low_19
Description: NF0187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0187_low_19
NF0187_low_19
[»] chr8 (1 HSPs)
chr8 (5-38)||(7863671-7863704)


Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 38
Target Start/End: Complemental strand, 7863704 - 7863671
Alignment:
5 ttccattggttttaggcatatcccttggagtata 38  Q
    ||||||||||||||||||||||||||||||||||    
7863704 ttccattggttttaggcatatcccttggagtata 7863671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 895 times since January 2019
Visitors: 2241