View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0187_low_19 (Length: 220)
Name: NF0187_low_19
Description: NF0187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0187_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 38
Target Start/End: Complemental strand, 7863704 - 7863671
Alignment:
| Q |
5 |
ttccattggttttaggcatatcccttggagtata |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7863704 |
ttccattggttttaggcatatcccttggagtata |
7863671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 895 times since January 2019
Visitors: 2241