View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0187_low_7 (Length: 270)
Name: NF0187_low_7
Description: NF0187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0187_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 29 - 221
Target Start/End: Original strand, 41128979 - 41129170
Alignment:
Q |
29 |
attatactggctgcaagagtcagaatcatcttctgattaacctgtcataaagttcaacaaaaaattaacacagcagcgataatgttatgctagattatgt |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41128979 |
attatactggctgcaagagtcagaatcatcttctgattaacctgtcataa-gttcaacaaaaaattaacacagcagcgataatgttatgctagattatgt |
41129077 |
T |
 |
Q |
129 |
gtataaagttgtgtgcgaaatatgaatgaatctcactgatggtggaaactatacctccataatatcctcaggtaacaaatatatggaacaacc |
221 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
41129078 |
gtataaagttgtgtgcgaaatatgaatgaatctcactgatggtggaaactatacctccataatatcctcaggtaacagatatatggaacaacc |
41129170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University