View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0188-INSERTION1 (Length: 153)
Name: NF0188-INSERTION1
Description: NF0188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0188-INSERTION1 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 7e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 7e-75
Query Start/End: Original strand, 8 - 153
Target Start/End: Original strand, 6857366 - 6857511
Alignment:
| Q |
8 |
ttattcaagttcttaataagtgctttccaaaacagtcccaattgggtgttagattcttcatttgggctggatttcaatctgggtatagacatagtggcta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6857366 |
ttattcaagttcttaataagtgctttccaaaacagtcccaattgggtgttagattcttcatttgggctggatttcaatctgggtatagacatagtggcta |
6857465 |
T |
|
| Q |
108 |
catgtataggaaagtttgtaacttgtttgagattgataagaatccg |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6857466 |
tatgtataggaaagtttgtaacttgtttgagattgataagaatccg |
6857511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 602 times since January 2019
Visitors: 2233