View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0188-INSERTION3 (Length: 201)
Name: NF0188-INSERTION3
Description: NF0188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0188-INSERTION3 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 7 - 201
Target Start/End: Complemental strand, 16192870 - 16192676
Alignment:
| Q |
7 |
agttaatcatattcttcatcaagttacacttccttcctctcacatagctgacaagcttgcttggaatgagaataactccagtgagttatctctcaaggat |
106 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
16192870 |
agttaatcatattgttcaccaagttacacttccttcctctcacatagctaacaagcttgcttggaatgagaataactccagtgagttatctctgaaggat |
16192771 |
T |
|
| Q |
107 |
gattacttggtaaaatccccatttagtcaaaattatcactggcctaaaacaatttgatcccctgatgtgcccctttccaattctatgttggtgtg |
201 |
Q |
| |
|
| ||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16192770 |
gcttacttggtaaaatccccattgagtcaaaattatcattgggctaaaacaatttgatcccctgatgtgcccctttccaattctatgttggtgtg |
16192676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 553 times since January 2019
Visitors: 2229