View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0188-INSERTION5 (Length: 411)
Name: NF0188-INSERTION5
Description: NF0188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0188-INSERTION5 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 146 - 411
Target Start/End: Original strand, 3239439 - 3239707
Alignment:
| Q |
146 |
acaggttatgca-ttttactgatgcagcacctgttgtggattggaagagaatttggaaattaaaggttaaagagagagtgagatgttttatgtggacctt |
244 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3239439 |
acaggttatgcaattttactgatgcagcacctgttgtggattggaagagaatttggaaattaaaggttccagagagagtgagatgttttatgtggacctt |
3239538 |
T |
 |
| Q |
245 |
ttgtcataatagattgttgacaaattatagaaaaagcaagatgggaatt-ggagtcctatgtgtgatgtctgtgcaaatactattgaggatgagttgc-t |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |||||||||| | |
|
|
| T |
3239539 |
ttgtcataatagattgttgacaaattatagaaaaagcaagatgggaattgggagtcctatgtgtgatgtctatgcaaatactattgaagatgagttgcat |
3239638 |
T |
 |
| Q |
343 |
gtgttaagggactgtcctaaagccatcgcattatggattagtgtagtgcataatggcgctagaaatgat |
411 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3239639 |
gtgttaagggactgtcctaaagccatggcattatggatcagtgtagtgcataatggcgctagaaatgat |
3239707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 10 - 116
Target Start/End: Original strand, 3239335 - 3239441
Alignment:
| Q |
10 |
tagttagtgggaacaattttgtaaagttgtctgcagaaaattcaagcaattacagctcgggatttggctaatggtgaagatactctaaattggcccggtg |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3239335 |
tagtgagtgggaacaattttgtaaagttgtctgcagaaaattcaagcaattacaactcgggatttggctaatggtgaagatactctaaattggcctggtg |
3239434 |
T |
 |
| Q |
110 |
atagaca |
116 |
Q |
| |
|
||||||| |
|
|
| T |
3239435 |
atagaca |
3239441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 307 - 350
Target Start/End: Original strand, 12810056 - 12810100
Alignment:
| Q |
307 |
tgatgtctgtgcaaatactattgaggatgagttgc-tgtgttaag |
350 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
12810056 |
tgatgtatgtgcaaatactattgaagatgagttgcatgtgttaag |
12810100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University