View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0188_high_3 (Length: 324)
Name: NF0188_high_3
Description: NF0188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0188_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 86 - 308
Target Start/End: Complemental strand, 34826495 - 34826275
Alignment:
| Q |
86 |
acacatgaaaagcaaattatgtccacatgcatatactagcggcaatcgacaaacacatgttgtttataaatttggttggtctttgatacctacgaaatca |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34826495 |
acacatgaaaagcaaattatgtccacatgcatatactagcggcaatcgacaaacacatgttgattataaatttggttggtctttgatacctacgaaatca |
34826396 |
T |
|
| Q |
186 |
accagttatataacactccaatatacacacatgcactagaaacatcaacaaaaattgatgtatttatataatacttctagatacactcattagatatatc |
285 |
Q |
| |
|
|||| |||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| || ||||||||||||| |
|
|
| T |
34826395 |
accaattatataacactgcaatatacacac--gcactagaaacatcaacaaaaattgatgtatttatataatacttctatatatacgcattagatatatc |
34826298 |
T |
|
| Q |
286 |
aacaaaaattgatgtatttgata |
308 |
Q |
| |
|
|||||||||| |||||||||||| |
|
|
| T |
34826297 |
aacaaaaattaatgtatttgata |
34826275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1096 times since January 2019
Visitors: 2243