View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0188_high_6 (Length: 223)

Name: NF0188_high_6
Description: NF0188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0188_high_6
NF0188_high_6
[»] chr8 (1 HSPs)
chr8 (1-129)||(12640472-12640600)
[»] chr4 (3 HSPs)
chr4 (1-98)||(48963349-48963446)
chr4 (1-84)||(48959207-48959290)
chr4 (1-93)||(48966395-48966487)
[»] chr6 (2 HSPs)
chr6 (1-88)||(12589219-12589306)
chr6 (9-98)||(12482477-12482566)
[»] chr2 (2 HSPs)
chr2 (1-98)||(13449429-13449526)
chr2 (1-94)||(13441266-13441359)


Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 12640600 - 12640472
Alignment:
1 ggccatgggatgcaaacagagttgctatgtcacccaaaggaatcatatgaccaggtgatagaaatggaagcaagtaaagtttcaatggccgttcaactcc 100  Q
    |||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||||| | |  ||||||||||||||||||||||||    
12640600 ggccatgggatgcaaacaaagctgctatgtcacccaaaggaatcatatgaccaggtgctagaaatggaagtatgagaagtttcaatggccgttcaactcc 12640501  T
101 gacactaccttccattgctgatcaatttt 129  Q
     |||| | |||||||||||||||| ||||    
12640500 aacaccatcttccattgctgatcagtttt 12640472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 58; Significance: 1e-24; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 48963349 - 48963446
Alignment:
1 ggccatgggatgcaaacagagttgctatgtcacccaaaggaatcatatgaccaggtgatagaaatggaagcaagtaaagtttcaatggccgttcaact 98  Q
    ||||| |||| |||||||||| |||||||||||||||||||||||||||||||||||  ||| ||||||  |||| |||||||||||| |||||||||    
48963349 ggccacgggacgcaaacagagctgctatgtcacccaaaggaatcatatgaccaggtgcaagatatggaatgaagtgaagtttcaatggtcgttcaact 48963446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 48959207 - 48959290
Alignment:
1 ggccatgggatgcaaacagagttgctatgtcacccaaaggaatcatatgaccaggtgatagaaatggaagcaagtaaagtttca 84  Q
    ||||||||||||||||||||||||||||||||| ||  || |||||||| ||||||| | || ||||||  |||| ||||||||    
48959207 ggccatgggatgcaaacagagttgctatgtcacacatggggatcatatgcccaggtgctggatatggaatgaagtgaagtttca 48959290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 48966395 - 48966487
Alignment:
1 ggccatgggatgcaaacagagttgctatgtcacccaaaggaatcatatgaccaggtgatagaaatggaagcaagtaaagtttcaatggccgtt 93  Q
    ||||||| |||||||| | |||||||||||||| || ||| |||||||| || |||| |||| ||||||  |||| |||||||| ||| ||||    
48966395 ggccatgagatgcaaagatagttgctatgtcacacatagggatcatatggcctggtgctagatatggaatgaagtgaagtttcagtggtcgtt 48966487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 12589306 - 12589219
Alignment:
1 ggccatgggatgcaaacagagttgctatgtcacccaaaggaatcatatgaccaggtgatagaaatggaagcaagtaaagtttcaatgg 88  Q
    ||||| ||||||||||||| ||||| |||||||  | ||| |||||||| |||||||||||| ||||||  |||| |||||| |||||    
12589306 ggccacgggatgcaaacagggttgcaatgtcacatagagggatcatatgcccaggtgatagatatggaatgaagtgaagttttaatgg 12589219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 9 - 98
Target Start/End: Complemental strand, 12482566 - 12482477
Alignment:
9 gatgcaaacagagttgctatgtcacccaaaggaatcatatgaccaggtgatagaaatggaagcaagtaaagtttcaatggccgttcaact 98  Q
    ||||||||||||||||| || |  | || ||| |||||||| ||||||| | |||||||||  |||| |||||||||||| |||||||||    
12482566 gatgcaaacagagttgcaatcttgcacatagggatcatatgcccaggtgctggaaatggaatgaagtgaagtttcaatggtcgttcaact 12482477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 13449429 - 13449526
Alignment:
1 ggccatgggatgcaaacagagttgctatgtcacccaaaggaatcatatgaccaggtgatagaaatggaagcaagtaaagtttcaatggccgttcaact 98  Q
    ||||| |||||||||||| |||||||||||||   | ||| |||||||| |||| ||  ||||||||||  ||||||| |||||||||  ||||||||    
13449429 ggccacgggatgcaaacatagttgctatgtcaaaaagagggatcatatgtccagatgcaagaaatggaatgaagtaaactttcaatggttgttcaact 13449526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 13441266 - 13441359
Alignment:
1 ggccatgggatgcaaacagagttgctatgtcacccaaaggaatcatatgaccaggtgatagaaatggaagcaagtaaagtttcaatggccgttc 94  Q
    ||||| |||||||||||| ||||||||||||||  | ||| |||||||| |||| || |||| ||||||  |||| || ||||| ||| |||||    
13441266 ggccacgggatgcaaacatagttgctatgtcacaaagagggatcatatgtccagatgctagatatggaatgaagtgaattttcagtggtcgttc 13441359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1199 times since January 2019
Visitors: 2246