View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0188_high_7 (Length: 211)
Name: NF0188_high_7
Description: NF0188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0188_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 5e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 37957915 - 37958110
Alignment:
| Q |
1 |
gcaattgttgttttgcctgtccctcccatgccccatattcctatgagacgaacactctgcgacttgaggagcaacaagggttggattcgttcaatatgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37957915 |
gcaattgttgttttgcctgtccctcccatgccccatattcctatgagacgaacactctgcgacttgaggagcaacaagggttggattcgttcaatatgct |
37958014 |
T |
 |
| Q |
101 |
cgtcaattccaatcattccttcatactcacttaagacaaagctattcannnnnnncaaaatatcttctgcaatcttttctacaaggctgctctctg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37958015 |
cgtcaattccaatcattccttcatactcacttaagacaaagctattcatttttttcaaaatatcttctgcaatcttttctacaaggctgctttctg |
37958110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 37929672 - 37929535
Alignment:
| Q |
1 |
gcaattgttgttttgcctgtccctcccatgccccatattcctatgagacgaacactctgcgacttgaggagcaacaagggttggattcgttcaatatgct |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||| |||||| | ||||| |||||||||||||| ||||||| ||||||||||| |
|
|
| T |
37929672 |
gcaattgttgttttgcctatccctcccatgccccgtattcctatgattcgaacagtagccgactcgaggagcaacaaggattggattttttcaatatgct |
37929573 |
T |
 |
| Q |
101 |
cgtcaattccaatcattccttcatactcacttaagaca |
138 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||| |
|
|
| T |
37929572 |
tttcaattcctatcattccttcataatcacttaagaca |
37929535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 34727847 - 34727887
Alignment:
| Q |
1 |
gcaattgttgttttgcctgtccctcccatgccccatattcc |
41 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34727847 |
gcaattgttgttttgccgatccctcccatgccccatattcc |
34727887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 34731005 - 34731045
Alignment:
| Q |
1 |
gcaattgttgttttgcctgtccctcccatgccccatattcc |
41 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34731005 |
gcaattgttgttttgccgatccctcccatgccccatattcc |
34731045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 18928879 - 18928839
Alignment:
| Q |
1 |
gcaattgttgttttgcctgtccctcccatgccccatattcc |
41 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
18928879 |
gcaattgttgttttgccgatccctcccataccccatattcc |
18928839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 34735604 - 34735640
Alignment:
| Q |
1 |
gcaattgttgttttgcctgtccctcccatgccccata |
37 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34735604 |
gcaattgttgttttgccgatccctcccatgccccata |
34735640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University