View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0188_low_2 (Length: 341)
Name: NF0188_low_2
Description: NF0188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0188_low_2 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 22 - 341
Target Start/End: Complemental strand, 36575403 - 36575084
Alignment:
| Q |
22 |
catcatcaattaagctttgctttcacttctcaagattaccacgaggctcttgaaaaatccattctcttctttgaaggacaacgatctggaaaattaccat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36575403 |
catcatcaattaagctttgctttcacttctcaagattaccacgaggctcttgaaaaatccattctcttctttgaaggacaacgatctggaaaattaccat |
36575304 |
T |
|
| Q |
122 |
ctaaccagaaactaacatggagaggagattctggattatcagatggctcttcttatcatgtattatacatactcatttgcatgactcattttttatatgt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36575303 |
ctaaccagaaactaacatggagaggagattctggattatcagatggctcttcttatcatgtattatacatactcatttgcatgactcattttttatatgt |
36575204 |
T |
|
| Q |
222 |
aagtttaatataacatgcatgttaattatttgtttgattattctctatatgtatattggttcaggtggacctaattggtggttattatgatgctggtgat |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36575203 |
aagtttaatataacatgcatgttaattatttgtttgattattctctatatgtatattggttcaggtggacctaattggaggttattatgatgctggtgat |
36575104 |
T |
|
| Q |
322 |
aaccttaagtttggtcttcc |
341 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
36575103 |
aaccttaagtttgggcttcc |
36575084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1069 times since January 2019
Visitors: 2243