View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0188_low_5 (Length: 277)
Name: NF0188_low_5
Description: NF0188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0188_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 77 - 259
Target Start/End: Complemental strand, 408801 - 408619
Alignment:
| Q |
77 |
tttgaaactatccctaaagtttcaactcttcaaaaagttacaaagagtttgggaaaatttacgtctattacataaaaagttataaagtatcattaagaag |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
408801 |
tttgaaactatccctaaagtttcaactcttcaaaaagttacaaagagtttgagaaaatttacgtctattacataaaaagttataaagtatcattaagaag |
408702 |
T |
 |
| Q |
177 |
ttacaagatgaaggcaagtgtgacactggttttcatccaaatttcccaaaatttgctggccctcttaatctgatcacacatct |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
408701 |
ttacaagatgaaggcaagtgtgacactggttttcatccaaatttcccaaaatttgctggccctcttaatctgatcacacatct |
408619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 30 - 75
Target Start/End: Complemental strand, 412916 - 412871
Alignment:
| Q |
30 |
agaacattatagaacaagggtttgtatacaaacatcttaaatttag |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
412916 |
agaacattatagaacaagggtttgtatacaaacatcttaaatttag |
412871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University