View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0190_low_2 (Length: 342)

Name: NF0190_low_2
Description: NF0190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0190_low_2
NF0190_low_2
[»] chr6 (5 HSPs)
chr6 (87-308)||(24168649-24168870)
chr6 (87-287)||(24179085-24179285)
chr6 (96-287)||(24188900-24189091)
chr6 (160-285)||(24151895-24152020)
chr6 (87-140)||(24112531-24112584)


Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-100; HSPs: 5)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 87 - 308
Target Start/End: Original strand, 24168649 - 24168870
Alignment:
87 agacattatcgttaactccgaaaataatgtttggttccgtctctttacacccactgttggtggagaagtcgtcggagatggtggtgcaaccaaaacaacc 186  Q
    |||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
24168649 agacattaccgttaactccgaaaataacgtttggttccgtctctttacacccactgttggcggagaagtcgtcggagatggtggtgcaaccaaaacaacc 24168748  T
187 tcccttcccgttgtcattttcttccatggtggcggcttcacctatctttgcccctcctctatctactatgatgctttttgtcgtagactctgctgggaaa 286  Q
    |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||    
24168749 tcccttcccgttgtcattttcttccacggtggtggcttcacctatctttgcccctcctctatctactatgatgctttttgccgtagactctgccgggaaa 24168848  T
287 tgtctgttgttgttgtctctgt 308  Q
    | || |||||||||||||||||    
24168849 tatccgttgttgttgtctctgt 24168870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 87 - 287
Target Start/End: Original strand, 24179085 - 24179285
Alignment:
87 agacattatcgttaactccgaaaataatgtttggttccgtctctttacacccactgttggtggagaagtcgtcggagatggtggtgcaaccaaaacaacc 186  Q
    |||| ||| ||||||| |||||||||| |||||||| ||||||||||| ||||||||||  |||||||||  ||||||||||||||| |||||| |||||    
24179085 agacgttaccgttaacgccgaaaataacgtttggtttcgtctctttacccccactgttgccggagaagtcaccggagatggtggtgccaccaaagcaacc 24179184  T
187 tcccttcccgttgtcattttcttccatggtggcggcttcacctatctttgcccctcctctatctactatgatgctttttgtcgtagactctgctgggaaa 286  Q
    |||||||| || |||||||||||||| || || |||| ||| | |||||  || ||||| | |  ||| || ||| |||| |||||||||||| ||||||    
24179185 tcccttcctgtcgtcattttcttccacggcggtggctacacttttctttctccttcctcgaacctctacgacgctgtttgccgtagactctgccgggaaa 24179284  T
287 t 287  Q
    |    
24179285 t 24179285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 96 - 287
Target Start/End: Original strand, 24188900 - 24189091
Alignment:
96 cgttaactccgaaaataatgtttggttccgtctctttacacccactgttggtggagaagtcgtcggagatggtggtgcaaccaaaacaacctcccttccc 195  Q
    ||||||||||||||| ||  ||||||||||||||||||| || |||||||  |||||||||  || |||||||||| | |||||||| ||||||||||||    
24188900 cgttaactccgaaaacaacctttggttccgtctctttactccaactgttgccggagaagtcaccgaagatggtggttccaccaaaactacctcccttccc 24188999  T
196 gttgtcattttcttccatggtggcggcttcacctatctttgcccctcctctatctactatgatgctttttgtcgtagactctgctgggaaat 287  Q
    || |||||||||||||| ||||| |||||||| | |||||   | ||||| | |  ||| |||||  ||||||||||||||||| |||||||    
24189000 gtcgtcattttcttccacggtggtggcttcacttttctttcttcttcctcaaacctctacgatgcggtttgtcgtagactctgccgggaaat 24189091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 160 - 285
Target Start/End: Original strand, 24151895 - 24152020
Alignment:
160 ggagatggtggtgcaaccaaaacaacctcccttcccgttgtcattttcttccatggtggcggcttcacctatctttgcccctcctctatctactatgatg 259  Q
    |||||||||||||| || ||||||||||||||||| ||  |||||| |||||| ||||| |||||||  | ||||| ||||||||| |||||  | ||||    
24151895 ggagatggtggtgccactaaaacaacctcccttcctgtcatcatttacttccacggtggtggcttcagttttctttccccctcctcaatctatcacgatg 24151994  T
260 ctttttgtcgtagactctgctgggaa 285  Q
    |||| || |||||||||||| |||||    
24151995 ctttatgccgtagactctgcagggaa 24152020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 87 - 140
Target Start/End: Original strand, 24112531 - 24112584
Alignment:
87 agacattatcgttaactccgaaaataatgtttggttccgtctctttacacccac 140  Q
    |||| ||||||||||| | ||| |||| ||||||||||||||||| ||||||||    
24112531 agacgttatcgttaacgcagaagataacgtttggttccgtctcttcacacccac 24112584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1530 times since January 2019
Visitors: 2192