View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0191_high_17 (Length: 258)
Name: NF0191_high_17
Description: NF0191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0191_high_17 |
 |  |
|
[»] scaffold0257 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0257 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: scaffold0257
Description:
Target: scaffold0257; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 11 - 258
Target Start/End: Complemental strand, 16087 - 15840
Alignment:
Q |
11 |
aatgggaagggaaagccgtcaaccaactgagcccacggcgtgacaaaagttaccttctctaaaaatttgtgacgaaatgttgtgcacaccaagactacaa |
110 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16087 |
aatgggaagggaaagccgtcaaccaaatgagcccacggcgtgacaaaagttaccttctctaaaaatttgtgacgaaatgttgtgcacaccaagactacaa |
15988 |
T |
 |
Q |
111 |
gcattatgccatatgttacgcaacaataccatagaggaattttttaagaccaacatggcactaatcaaatcgctctctaaccaaatatgattccacccat |
210 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
15987 |
gcattatgccatatgttacgcaacaataccagagaggaattttttaagaccaacatggcactaatcaaatcgctctctaaccaaatatggttccacccat |
15888 |
T |
 |
Q |
211 |
tttgagcagctcagacattccaataaaagaaattcattgaggagatga |
258 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15887 |
tttgagcagctcagacattccaataaaagaaattcattgaggagatga |
15840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 218
Target Start/End: Complemental strand, 24373161 - 24373121
Alignment:
Q |
178 |
aatcgctctctaaccaaatatgattccacccattttgagca |
218 |
Q |
|
|
|||| ||||||||||||||||| ||||||||||||||||| |
|
|
T |
24373161 |
aatcactctctaaccaaatatgtctccacccattttgagca |
24373121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University