View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0191_high_18 (Length: 257)
Name: NF0191_high_18
Description: NF0191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0191_high_18 |
 |  |
|
[»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 13219297 - 13219425
Alignment:
Q |
1 |
gctggtcatatgtatagaactaacttcggtattgggcacagtataaaagagattttagaagcacatattcctccggggggtagattggggcgtggacata |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
13219297 |
gctggtcatatgtatagaactaacttcggtattgggcacagtataaaagatattttagaagcacatattcctccggggggtagattgggccgtggacata |
13219396 |
T |
 |
Q |
101 |
agggtctttatgacacaatcaataattca |
129 |
Q |
|
|
||||||||||||||||||||||||||||| |
|
|
T |
13219397 |
agggtctttatgacacaatcaataattca |
13219425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 4 - 128
Target Start/End: Complemental strand, 238409 - 238285
Alignment:
Q |
4 |
ggtcatatgtatagaactaacttcggtattgggcacagtataaaagagattttagaagcacatattcctccggggggtagattggggcgtggacataagg |
103 |
Q |
|
|
||||| |||||| ||||||||||||| |||||||||||||| ||||| |||||||||| |||| ||||||||||||| |||| |||||||| ||||||| |
|
|
T |
238409 |
ggtcacatgtatcgaactaacttcggaattgggcacagtattaaagatcttttagaagcgcatactcctccggggggtcgattagggcgtgggcataagg |
238310 |
T |
 |
Q |
104 |
gtctttatgacacaatcaataattc |
128 |
Q |
|
|
| ||||||||||||||||| ||||| |
|
|
T |
238309 |
gcctttatgacacaatcaacaattc |
238285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University