View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0191_high_23 (Length: 215)
Name: NF0191_high_23
Description: NF0191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0191_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 25408328 - 25408526
Alignment:
Q |
1 |
gcgctcgtactgcacttgcgtttgttactctacgcgccgatggagagcgtgagttcatgttttacagaaatccgagtgctgatatgcttcttactcctga |
100 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
25408328 |
gcgctcgtactgcactcgcgtttgttactctacgcgccgatggagagcgtgagttcatgttttacagaaatccgagtgctgacatgcttcttactcctga |
25408427 |
T |
 |
Q |
101 |
agatctcaatcttgaactcatcagatctgtatgcaaatttcttcactttctctctcaaatttcttgtttcnnnnnnngatttgatagtgtagtgatgat |
199 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
T |
25408428 |
agatctcaatcttgaactcatcagatctgtatgcaaatttcttcactttctctctcaaatttcttgtttctttttttgatttgatagtgtagttatgat |
25408526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 18 - 131
Target Start/End: Original strand, 42375318 - 42375431
Alignment:
Q |
18 |
gcgtttgttactctacgcgccgatggagagcgtgagttcatgttttacagaaatccgagtgctgatatgcttcttactcctgaagatctcaatcttgaac |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||||| |||||||||| |||||||| |||||||| |||| |
|
|
T |
42375318 |
gcgtttgttactctacgcgccgatggagagcgtgagtttatgttttatagaaatccaagtgctgacatgcttcttaaacctgaagaactcaatctcgaac |
42375417 |
T |
 |
Q |
118 |
tcatcagatctgta |
131 |
Q |
|
|
|||||||||||||| |
|
|
T |
42375418 |
tcatcagatctgta |
42375431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 91
Target Start/End: Complemental strand, 46030717 - 46030665
Alignment:
Q |
39 |
gatggagagcgtgagttcatgttttacagaaatccgagtgctgatatgcttct |
91 |
Q |
|
|
||||| ||||| |||||| |||||| | ||||||| ||||||||||||||||| |
|
|
T |
46030717 |
gatggcgagcgcgagttcttgtttttccgaaatcctagtgctgatatgcttct |
46030665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University