View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0191_low_12 (Length: 379)
Name: NF0191_low_12
Description: NF0191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0191_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 5 - 289
Target Start/End: Complemental strand, 45000023 - 44999751
Alignment:
| Q |
5 |
atgaagagttttgcagctaaagtagaagaaggaagagaaggcaaaaatggcaagctatctgtaggtccagtatatcgcaaccttctagctaaagatcaat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45000023 |
atgaagagttttgcagctaaagtagaagaaggaagagaaggcaaaaatggcaagctatctgtaggtccagtatatcgcaaccttctagctaaagatcaat |
44999924 |
T |
|
| Q |
105 |
ttccaccatctgatcctgatttaactacagcttgggatattttcaggtatatgatatttttcatgcnnnnnnngttggttttaaattgagttacgacgtt |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
44999923 |
ttccaccatctgatcctgatttaactacagcttgggatattttcaggtatatg-ta-----------aaaaaagttggttttaaattgagttacgacgtt |
44999836 |
T |
|
| Q |
205 |
gttgaccacaatttaaaactatgcttagaatatactataaattgatcaaagagtaatgataattaactttcctaatgagcttcct |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44999835 |
gttgaccacaatttaaaactatgcttagaatatactataaattgatcaaagagtaatgataattaactttcctaatgagcttcct |
44999751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 865 times since January 2019
Visitors: 2241