View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0191_low_19 (Length: 337)
Name: NF0191_low_19
Description: NF0191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0191_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 115 - 256
Target Start/End: Complemental strand, 43506893 - 43506752
Alignment:
| Q |
115 |
aacctgtgaatgtgatcacagactccgaaaaactcttctattccatcacagtgtgaataattctctccactcccagcttcgctccaagggacattctctt |
214 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43506893 |
aacctatgaatgtgatcacagactccgaaaaactcttctattccatcacagtgtgaataattctctccactcccagcttcgctccaagggacattctctt |
43506794 |
T |
 |
| Q |
215 |
agaacctctcgctgcaatttgttaaacttcttattgcaacag |
256 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||| ||||| |
|
|
| T |
43506793 |
agaacctcttgctgtaatttgttaaacttcttattgtaacag |
43506752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University