View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0191_low_20 (Length: 322)
Name: NF0191_low_20
Description: NF0191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0191_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 74 - 227
Target Start/End: Original strand, 7948320 - 7948473
Alignment:
| Q |
74 |
ggagcagcagagactgttaaccaaggcagagaaagcaggtttattatcggcagccgagaaagcaggattatctctctcaacaatagagaaacttggtctc |
173 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7948320 |
ggagcaactgagactgttaaccaaggcagagaaagcaggtttattatcggcagccgagaaagcaggattatctctctcaacaatagagaaacttggtctc |
7948419 |
T |
|
| Q |
174 |
ctttcaaaagcagaagaacttggtgtcttatcagctgctactgatccatcaact |
227 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7948420 |
ctttcaaaagcagaagaacttggtgttttatcagctgctactgatccatcaact |
7948473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 995 times since January 2019
Visitors: 2242