View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0191_low_23 (Length: 313)
Name: NF0191_low_23
Description: NF0191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0191_low_23 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 93 - 313
Target Start/End: Original strand, 45445186 - 45445406
Alignment:
| Q |
93 |
attcgagcattgtctttgtaacctgcttcacaataaatat----tatccgatgctttcatcattaaagattagaaacccttgcatgaaaattctgagtat |
188 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45445186 |
attcgagcattgtctttgtaatctgcttcacaataaatatatattatccgatgctttcatcattaaagattagaaacccttgcatgaaaattctgagtat |
45445285 |
T |
 |
| Q |
189 |
agaagtggatccccagctagtacgtggataccatactctcatcaaaagaatcgaaataaaaggctagtgaagataacagaaactcctgtaggacgaagtc |
288 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45445286 |
agaagtggatccccagctagt----ggataccatactctcatcaaaagaatcgaaataaaaggctagtgaagataacagaaactcctgtaggacgaagtc |
45445381 |
T |
 |
| Q |
289 |
aattctcgtcgtgttggtcgccaac |
313 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45445382 |
aattctcgtcgtgttggtcgccaac |
45445406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University