View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0191_low_25 (Length: 311)
Name: NF0191_low_25
Description: NF0191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0191_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 133 - 224
Target Start/End: Original strand, 7381388 - 7381479
Alignment:
| Q |
133 |
accaaatattatggtgcaaataaagttcggtatttctcgttggggattgaggatgaagagagagaagatgttgaaaagttaagtgatgatgt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7381388 |
accaaatattatggtgcaaataaagttcggtatttctcgttggggattgaggatgaagagagagaagatgttgaaaagttaagtgatgatgt |
7381479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 7381256 - 7381308
Alignment:
| Q |
1 |
gaagaaggacataaagttgtgagatgttctgatgaagaatcacttcatcgtgc |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7381256 |
gaagaaggacataaagttgtgagatgttctgatgaagaatcacttcatcgtgc |
7381308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University