View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0191_low_27 (Length: 310)
Name: NF0191_low_27
Description: NF0191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0191_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 13 - 305
Target Start/End: Complemental strand, 34860443 - 34860151
Alignment:
| Q |
13 |
tgagatatctttaaaagacattgatcaagttgccaagagctcatttcctctgtgcatgcgtcacctgtttgataaggtaagagatcagtcataaactacg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34860443 |
tgagatatctttaaaagacattgatcaagttgccaagagctcatttcctctgtgcatgcgtcacctgtttgataaggtaagagatcagtcataaactacg |
34860344 |
T |
 |
| Q |
113 |
atccatatattgtgtttctcaattctcacactgcagttcatttttaatttcnnnnnnnncttcttaactcatcttttataacgagtcttcattttgtcct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34860343 |
atccatatattgtgtttctcaattctcactctgcagttcatttttaatttcttttttttcttcttaactcatcttttataacgagtcttcattttgtcct |
34860244 |
T |
 |
| Q |
213 |
tttcttgtctcatctgtcctgactcttgatttatgccacccttatgcagctgaaagaggaccatcatttaaagcacggtggaaggatgcaact |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34860243 |
tttcttgtctcatctgtcctgactcttgatttatgccacccttgtgcagctgaaagaggaccatcatttaaagcacggtggaaggatgcaact |
34860151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 35 - 126
Target Start/End: Original strand, 40273014 - 40273105
Alignment:
| Q |
35 |
gatcaagttgccaagagctcatttcctctgtgcatgcgtcacctgtttgataaggtaagagatcagtcataaactacgatccatatattgtg |
126 |
Q |
| |
|
|||||||||||||| | |||||||||| || || | |||| |||||||||||| |||||||| |||||||||| ||||||||||||||| |
|
|
| T |
40273014 |
gatcaagttgccaataactcatttccttggtacacacatcacttgtttgataaggctagagatcaatcataaactatgatccatatattgtg |
40273105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University