View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0191_low_31 (Length: 275)
Name: NF0191_low_31
Description: NF0191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0191_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 215 - 255
Target Start/End: Complemental strand, 33548952 - 33548912
Alignment:
| Q |
215 |
cttcattcattcaatttaataaataatacatcggacaacac |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33548952 |
cttcattcattcaatttaataaataatacatcggacaacac |
33548912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 813 times since January 2019
Visitors: 2240