View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0191_low_32 (Length: 272)
Name: NF0191_low_32
Description: NF0191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0191_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 35 - 130
Target Start/End: Original strand, 2820017 - 2820112
Alignment:
Q |
35 |
gcagtgctattctttggaatctctatcctctttgagttgttgtgcattattctctatgcaatctactttcctaagttgtccattgtagagtattat |
130 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2820017 |
gcagtgctattctttggaatctctatcttctttgagttgttgtgcattattctctatgcaatctactttcctaagttgtccattgtagagtattat |
2820112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 35 - 131
Target Start/End: Original strand, 2827187 - 2827283
Alignment:
Q |
35 |
gcagtgctattctttggaatctctatcctctttgagttgttgtgcattattctctatgcaatctactttcctaagttgtccattgtagagtattatc |
131 |
Q |
|
|
|||||||||||||||||||| |||| | |||||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||| | ||||||| |
|
|
T |
2827187 |
gcagtgctattctttggaatatctaccttctttgagtttttgtgcattattctctatgcaatctacttccctaagttgaccattgtaaaatattatc |
2827283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 207 - 268
Target Start/End: Complemental strand, 34142336 - 34142275
Alignment:
Q |
207 |
ttactcaatgtactctctctaatatgctctttgtcgtttgtttatattaccatctttccctc |
268 |
Q |
|
|
||||||| |||||| ||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
T |
34142336 |
ttactcattgtactatctctaatatgctctttgtcgtttgttgatattaccatcttgccctc |
34142275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University