View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0191_low_38 (Length: 244)
Name: NF0191_low_38
Description: NF0191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0191_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 30079228 - 30079103
Alignment:
Q |
1 |
taaaaacagaagcttattcccccaatccgtttcttcctcagacaatctcctaaaatcccatgttatccttcccgcaacaagaaaatgatccttcccattc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30079228 |
taaaaacagaagcttattcccccaatccgtttcttcctcagacaatctccgaaaatcccatgttatccttcccgcaacaagaaaatgatccttcccattc |
30079129 |
T |
 |
Q |
101 |
atgatactccactccggcctcttcat |
126 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
30079128 |
atgatactccactccggcctcttcat |
30079103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 39485919 - 39486044
Alignment:
Q |
1 |
taaaaacagaagcttattcccccaatccgtttcttcctcagacaatctcctaaaatcccatgttatccttcccgcaacaagaaaatgatccttcccattc |
100 |
Q |
|
|
|||||||| ||||||||| |||||||| |||| |||||| |||||||||||||||||| || ||||| || ||||||||||||||||| |||||||| |
|
|
T |
39485919 |
taaaaacaaaagcttattaccccaatctttttcatcctcactcaatctcctaaaatcccaagtaatcctaccagcaacaagaaaatgatctctcccattc |
39486018 |
T |
 |
Q |
101 |
atgatactccactccggcctcttcat |
126 |
Q |
|
|
|| | || ||| ||||| |||||||| |
|
|
T |
39486019 |
ataacaccccattccggtctcttcat |
39486044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1075 times since January 2019
Visitors: 2243