View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0191_low_39 (Length: 244)
Name: NF0191_low_39
Description: NF0191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0191_low_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 30079204 - 30079338
Alignment:
| Q |
1 |
ttgggggaataagcttctgtttttaccggcagcgaagaatatgtccatgcttgtggtagagtcgagtccatggaatgcaaatgattttgggattccttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30079204 |
ttgggggaataagcttctgtttttaccggcagcgaagaatatgtccatgcttgtggtagagtcgagtccatggaatgcaaatgattttgggattccttat |
30079303 |
T |
|
| Q |
101 |
cctacatatttccaccctgcaaaagatgatgatgt |
135 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||| |
|
|
| T |
30079304 |
cctacatacttccaccctgcaaaagatgctgatgt |
30079338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 39485943 - 39485817
Alignment:
| Q |
1 |
ttgggggaataagcttctgtttttaccggcagcgaagaatatgtccatgcttgtggtagagtcgagtccatggaatgcaaatgattttgggattccttat |
100 |
Q |
| |
|
|||||| ||||||||| |||||||||| || || ||||||||||| |||||||| || || || ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
39485943 |
ttggggtaataagcttttgtttttacctgctgctaagaatatgtctatgcttgttgttgaatctagtccttggaatgctaatgattttgggattccttat |
39485844 |
T |
|
| Q |
101 |
cctacatatttccaccctgcaaaagat |
127 |
Q |
| |
|
|| || |||||||| || || |||||| |
|
|
| T |
39485843 |
ccgacgtatttccatcccgcgaaagat |
39485817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 136
Target Start/End: Original strand, 20401620 - 20401691
Alignment:
| Q |
64 |
gagtccatggaatgcaaatgattttgggattccttatcctacatatttccaccctgcaaaagatgatgatgtc |
136 |
Q |
| |
|
|||||| |||||||| ||| |||| ||||||||||||||| ||||||||||||| |||||| ||||||||| |
|
|
| T |
20401620 |
gagtccttggaatgctaattatttcaagattccttatcctacttatttccaccctg-aaaagacgatgatgtc |
20401691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 715 times since January 2019
Visitors: 2236