View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0191_low_43 (Length: 221)
Name: NF0191_low_43
Description: NF0191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0191_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 25408352 - 25408165
Alignment:
| Q |
1 |
acaaacgcaagtgcagtacgagcgcctttgtcaaagttgataccatcccctctcacgttgttttctttcaagatcccggcgagcatgtgaccgaattcat |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25408352 |
acaaacgcgagtgcagtacgagcgcctttgtcaaagttgataccatcccctctcacgttgttttctttcaagatcccggcgagcatgtgaccgaattcat |
25408253 |
T |
|
| Q |
101 |
catcaccgagttttccgacgaaggctgatttaccaccgagtcgtgaaacagcgatcgcaacgttagcgggtgcgccaccgggagcttt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25408252 |
catcaccgagttttccgacgaaggctgatttaccaccgagtcgtgaaacagcgatcgcaacgttagcgggtgcgccaccgggagcttt |
25408165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 60 - 188
Target Start/End: Complemental strand, 42375266 - 42375138
Alignment:
| Q |
60 |
gttttctttcaagatcccggcgagcatgtgaccgaattcatcatcaccgagttttccgacgaaggctgatttaccaccgagtcgtgaaacagcgatcgca |
159 |
Q |
| |
|
|||||| || ||||||||||| |||||||||||||| || ||||| || ||||| ||||| ||||| | |||||| || | ||| ||||||||||| || |
|
|
| T |
42375266 |
gttttcctttaagatcccggcaagcatgtgaccgaactcgtcatcgcctagtttcccgacaaaggcagctttaccgcctaatcgggaaacagcgatggcg |
42375167 |
T |
|
| Q |
160 |
acgttagcgggtgcgccaccgggagcttt |
188 |
Q |
| |
|
||||| || ||||| || ||||||||||| |
|
|
| T |
42375166 |
acgttcgctggtgcaccgccgggagcttt |
42375138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1048 times since January 2019
Visitors: 2243