View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0191_low_45 (Length: 216)
Name: NF0191_low_45
Description: NF0191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0191_low_45 |
 |  |
|
[»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 13219297 - 13219500
Alignment:
Q |
1 |
gctggtcatatgtatagaactaacttcggtattgggcacagtataaaagagattttagaagcacatattcctccggggggtagattggggcgtggacata |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
13219297 |
gctggtcatatgtatagaactaacttcggtattgggcacagtataaaagatattttagaagcacatattcctccggggggtagattgggccgtggacata |
13219396 |
T |
 |
Q |
101 |
agggtctttatgacacaatcaataattcaattcattttcaattaggccttgctctagcctcattaggggtcattacttctttggtagctcaacacatgta |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13219397 |
agggtctttatgacacaatcaataattcaattcattttcaattaggccttgctctagcctcattaggggtcattacttctttggtagctcaacacatgta |
13219496 |
T |
 |
Q |
201 |
ctct |
204 |
Q |
|
|
|||| |
|
|
T |
13219497 |
ctct |
13219500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 4 - 204
Target Start/End: Complemental strand, 238409 - 238209
Alignment:
Q |
4 |
ggtcatatgtatagaactaacttcggtattgggcacagtataaaagagattttagaagcacatattcctccggggggtagattggggcgtggacataagg |
103 |
Q |
|
|
||||| |||||| ||||||||||||| |||||||||||||| ||||| |||||||||| |||| ||||||||||||| |||| |||||||| ||||||| |
|
|
T |
238409 |
ggtcacatgtatcgaactaacttcggaattgggcacagtattaaagatcttttagaagcgcatactcctccggggggtcgattagggcgtgggcataagg |
238310 |
T |
 |
Q |
104 |
gtctttatgacacaatcaataattcaattcattttcaattaggccttgctctagcctcattaggggtcattacttctttggtagctcaacacatgtactc |
203 |
Q |
|
|
| ||||||||||||||||| ||||| ||||||||||| ||||| ||||||||||| || |||||||| |||||||| || ||||||||||| |||||||| |
|
|
T |
238309 |
gcctttatgacacaatcaacaattcgattcattttcagttaggtcttgctctagcttctttaggggttattacttccttagtagctcaacatatgtactc |
238210 |
T |
 |
Q |
204 |
t |
204 |
Q |
|
|
| |
|
|
T |
238209 |
t |
238209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 125 - 204
Target Start/End: Original strand, 10996334 - 10996413
Alignment:
Q |
125 |
attcaattcattttcaattaggccttgctctagcctcattaggggtcattacttctttggtagctcaacacatgtactct |
204 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10996334 |
attcaattcattttcaattaggccttgctctagcctcattaggggtcattacttctttggtagctcaacacatgtactct |
10996413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 167 - 200
Target Start/End: Complemental strand, 32566683 - 32566650
Alignment:
Q |
167 |
gggtcattacttctttggtagctcaacacatgta |
200 |
Q |
|
|
|||||||||||||||||||||||||| ||||||| |
|
|
T |
32566683 |
gggtcattacttctttggtagctcaatacatgta |
32566650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1140 times since January 2019
Visitors: 2244