View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0191_low_46 (Length: 215)

Name: NF0191_low_46
Description: NF0191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0191_low_46
NF0191_low_46
[»] chr4 (1 HSPs)
chr4 (1-199)||(25408328-25408526)
[»] chr2 (1 HSPs)
chr2 (18-131)||(42375318-42375431)
[»] chr1 (1 HSPs)
chr1 (39-91)||(46030665-46030717)


Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 25408328 - 25408526
Alignment:
1 gcgctcgtactgcacttgcgtttgttactctacgcgccgatggagagcgtgagttcatgttttacagaaatccgagtgctgatatgcttcttactcctga 100  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
25408328 gcgctcgtactgcactcgcgtttgttactctacgcgccgatggagagcgtgagttcatgttttacagaaatccgagtgctgacatgcttcttactcctga 25408427  T
101 agatctcaatcttgaactcatcagatctgtatgcaaatttcttcactttctctctcaaatttcttgtttcnnnnnnngatttgatagtgtagtgatgat 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||| |||||    
25408428 agatctcaatcttgaactcatcagatctgtatgcaaatttcttcactttctctctcaaatttcttgtttctttttttgatttgatagtgtagttatgat 25408526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 18 - 131
Target Start/End: Original strand, 42375318 - 42375431
Alignment:
18 gcgtttgttactctacgcgccgatggagagcgtgagttcatgttttacagaaatccgagtgctgatatgcttcttactcctgaagatctcaatcttgaac 117  Q
    |||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||||| ||||||||||  |||||||| |||||||| ||||    
42375318 gcgtttgttactctacgcgccgatggagagcgtgagtttatgttttatagaaatccaagtgctgacatgcttcttaaacctgaagaactcaatctcgaac 42375417  T
118 tcatcagatctgta 131  Q
    ||||||||||||||    
42375418 tcatcagatctgta 42375431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 39 - 91
Target Start/End: Complemental strand, 46030717 - 46030665
Alignment:
39 gatggagagcgtgagttcatgttttacagaaatccgagtgctgatatgcttct 91  Q
    ||||| ||||| |||||| |||||| | ||||||| |||||||||||||||||    
46030717 gatggcgagcgcgagttcttgtttttccgaaatcctagtgctgatatgcttct 46030665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1004 times since January 2019
Visitors: 2242