View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0191_low_49 (Length: 202)
Name: NF0191_low_49
Description: NF0191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0191_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 1734666 - 1734550
Alignment:
| Q |
1 |
atgatcacagagagagaaagagctcaagggatgaggatgttcgtggggaaagaaagtacagaggggacgatgattatcatggagagagaaagcgcagcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1734666 |
atgatcacagagagagaaagagctcaagggatgaggatgttcgtggggaaagaaagtacagaggggacgatgattatcatggagagagaaagcgcagcag |
1734567 |
T |
|
| Q |
101 |
aagggatgatgatgatg |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
1734566 |
aagggatgatgatgatg |
1734550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1085 times since January 2019
Visitors: 2243