View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0191_low_9 (Length: 457)
Name: NF0191_low_9
Description: NF0191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0191_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 14 - 360
Target Start/End: Original strand, 36068050 - 36068396
Alignment:
Q |
14 |
agattagtgttaacatcaatttacttgaaataaatgaaacaactatctcatagagtgcaaaatgttaaaaatttaaacctattggttgttcgaaaaatgg |
113 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
36068050 |
agattagtgttaacatcaatttacttgaaataaatgaaacaactatctcatagagtgcaaaatgttaaaaatttaaacctattggttgttcgaaatatgg |
36068149 |
T |
 |
Q |
114 |
ataaggatcatatctaacaacacaacttggatagaaaacacttcctctaatctttcctttagcacacgaggtttgcagataatttatagcatcatttaaa |
213 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36068150 |
ataaggatcatatctaacaacacaacttggatataaaacacttcctctaatctttcctttagcacacgaggtttgcagataatttatagcatcatttaaa |
36068249 |
T |
 |
Q |
214 |
cacttcatgcaattatcattagagagatttggtatgcattgagcaaggccatacaagaatttgtcctcaaagaaaattgctctcttgagaacaaatttga |
313 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36068250 |
cacttcatgcaattatcattagagagatttggtatgcattgagcaaggccatacaagaatttgtcctcaaagaaaattgctctcttgagaacaaatttga |
36068349 |
T |
 |
Q |
314 |
tagaatttcccgttgaagttttaatagcttgagttacaggcttcttc |
360 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36068350 |
tagaatttcccgttgaagttttaatagcttgagttacaggcttcttc |
36068396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 775 times since January 2019
Visitors: 2239