View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0192_high_5 (Length: 335)

Name: NF0192_high_5
Description: NF0192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0192_high_5
NF0192_high_5
[»] chr2 (1 HSPs)
chr2 (1-210)||(39298962-39299171)


Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 39298962 - 39299171
Alignment:
1 ccgccactttgcttgcaacttccacagcagtcttccctgtctctacagtaacatcctttgcctgaacaactgcagacttggctttctccgccacaggggt 100  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39298962 ccgccactttgcttgcaacttccgcagcagtcttccctgtctctacagtaacatcctttgcctgaacaactgcagacttggctttctccgccacaggggt 39299061  T
101 agcatattctgttgcagtttttgcagcgcttgaaacagtgtcttttgttgcttcataaccttgttgtgttttctcaagagttgcatctttggcttgtgct 200  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
39299062 aacatattctgttgcagtttttgcagcgcttgaaacagtgtcttttgttgcttcataaccttgttgtgttttctcaacagttgcatctttggcttgtgct 39299161  T
201 gctttctcca 210  Q
    ||||||||||    
39299162 gctttctcca 39299171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 10501 times since January 2019
Visitors: 10027