View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0192_low_10 (Length: 251)
Name: NF0192_low_10
Description: NF0192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0192_low_10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 30 - 251
Target Start/End: Original strand, 2796233 - 2796454
Alignment:
| Q |
30 |
ggccgatcagctgaatgcggaaattgttctcggtaccgttcaaaatgcgaaggaagcttgcaattggatcggatacacttacctgtacgtgcgtatgtca |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2796233 |
ggccgatcagctgaatgcggaaattgttctcggtaccgttcaaaatgcgaaggaagcttgcaattggatcggatacacttacttgtacgtgcgtatgtca |
2796332 |
T |
|
| Q |
130 |
aggaatccttctctgtatggtttagcaccggatgttgttatgcgggatataacattggaggagaggagggctgatttggtaagcatctcaatctttaatt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2796333 |
aggaatccttctctgtatggtttagcaccggatgttgttatgcgggatataacattggaggagaggagggctgatttggtaagcatctcaatctttaatt |
2796432 |
T |
|
| Q |
230 |
tatcacactcttattattttat |
251 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2796433 |
tatcacactcttattattttat |
2796454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 34 - 234
Target Start/End: Original strand, 29263750 - 29263949
Alignment:
| Q |
34 |
gatcagctgaatgcggaaattgttctcggtaccgttcaaaatgcgaaggaagcttgcaattggatcggatacacttacctgtacgtgcgtatgtcaagga |
133 |
Q |
| |
|
|||||||||||||| || |||||||||||||| ||||| ||||| |||||||| || ||||||| |||||||| |||||||| || || |||| |||| |
|
|
| T |
29263750 |
gatcagctgaatgcagagattgttctcggtacagttcagaatgcaaaggaagcctgtcattggattggatacacgtacctgtatgttcgcatgttgagga |
29263849 |
T |
|
| Q |
134 |
atccttctctgtatggtttagcaccggatgttgttatgc-gggatataacattggaggagaggagggctgatttggtaagcatctcaatctttaatttat |
232 |
Q |
| |
|
|||| ||||| || || |||||||| |||| | ||| | | ||||||||||||||||| ||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
29263850 |
atccgtctctttacgggttagcaccagatg-tcctatccagagatataacattggaggaaaggagggctgatttggtaagcatctcagt-tttaatttat |
29263947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 34 - 86
Target Start/End: Complemental strand, 29189003 - 29188951
Alignment:
| Q |
34 |
gatcagctgaatgcggaaattgttctcggtaccgttcaaaatgcgaaggaagc |
86 |
Q |
| |
|
|||||||||||||| || |||||||||||||| |||||||||| ||||||||| |
|
|
| T |
29189003 |
gatcagctgaatgcagagattgttctcggtacagttcaaaatgtgaaggaagc |
29188951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 903 times since January 2019
Visitors: 1516