View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0192_low_2 (Length: 392)
Name: NF0192_low_2
Description: NF0192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0192_low_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 107 - 380
Target Start/End: Original strand, 39298682 - 39298955
Alignment:
| Q |
107 |
aacagaacctgaagttgaccagaagcccttttagtctcatagtcacgccatgattcatctttcttcttagcagtaaactccttagcagtctcgccagcag |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39298682 |
aacagaacctgaagttgaccagaagcccttttagtctcatattcacgccatgattcatctttcttcttagcagtaaactccttagcagtctcaccagcag |
39298781 |
T |
|
| Q |
207 |
aagcagccaaacctttcacaacatccaccgatttcgacgcaagctcggccgcctttggtacaacatatccagccgctccttcaacagcatgcgctgcagc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39298782 |
aagcagccaaacctttcacaacatccaccgatttcaacgcaagcccggccgcctttggtacaacatatccagccgctccttcaacagcatgcgctgcagc |
39298881 |
T |
|
| Q |
307 |
cttagttccatccacggtcaacttcgtcgaataatgtgccgcagtccaccctgccacggtggccttatccttca |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39298882 |
cttagttccatccacggtcaacttcgtcgaataatgtgccgcagtccaccctgccacggtggccttatccttca |
39298955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 912 times since January 2019
Visitors: 1516