View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0192_low_4 (Length: 338)
Name: NF0192_low_4
Description: NF0192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0192_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 107 - 260
Target Start/End: Original strand, 39298682 - 39298835
Alignment:
| Q |
107 |
aacagaacctgaagttgaccagaagcccttttagtctcatagtcacgccatgattcatctttcttcttagcagtaaactccttagcagtctcgccagcag |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39298682 |
aacagaacctgaagttgaccagaagcccttttagtctcatattcacgccatgattcatctttcttcttagcagtaaactccttagcagtctcaccagcag |
39298781 |
T |
 |
| Q |
207 |
aagcagccaaacctttcacaacatccaccgatttcgacgcaagctcggccgcct |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
39298782 |
aagcagccaaacctttcacaacatccaccgatttcaacgcaagcccggccgcct |
39298835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University