View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0192_low_5 (Length: 335)
Name: NF0192_low_5
Description: NF0192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0192_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 39298962 - 39299171
Alignment:
| Q |
1 |
ccgccactttgcttgcaacttccacagcagtcttccctgtctctacagtaacatcctttgcctgaacaactgcagacttggctttctccgccacaggggt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39298962 |
ccgccactttgcttgcaacttccgcagcagtcttccctgtctctacagtaacatcctttgcctgaacaactgcagacttggctttctccgccacaggggt |
39299061 |
T |
|
| Q |
101 |
agcatattctgttgcagtttttgcagcgcttgaaacagtgtcttttgttgcttcataaccttgttgtgttttctcaagagttgcatctttggcttgtgct |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39299062 |
aacatattctgttgcagtttttgcagcgcttgaaacagtgtcttttgttgcttcataaccttgttgtgttttctcaacagttgcatctttggcttgtgct |
39299161 |
T |
|
| Q |
201 |
gctttctcca |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
39299162 |
gctttctcca |
39299171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 831 times since January 2019
Visitors: 1512