View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0192_low_6 (Length: 328)
Name: NF0192_low_6
Description: NF0192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0192_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 8e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 158 - 318
Target Start/End: Complemental strand, 48924204 - 48924044
Alignment:
| Q |
158 |
tgtcttcaaaacataaatgaatgatattattattattagacttattttcgatggtaattcactcccaatggacatccgacatccattttccatatattca |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48924204 |
tgtcttcaaaacataaatgaatgatattattattattagacttattttcgatggtaattcactcccaatggacatccgacatccattttccatatattca |
48924105 |
T |
 |
| Q |
258 |
catatttagaatattaaagctatgtttgttgttttttgaatgctgaaagtgaagttctgtg |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48924104 |
catatttagaatattaaagctatgtttgttgttttttgaatgctgaaagtgaagttctgtg |
48924044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 30 - 144
Target Start/End: Complemental strand, 48924300 - 48924188
Alignment:
| Q |
30 |
ttaagtaacctatgtgaagtgtgatgtatcgttgcatccttttctgaattgtatgttaggtgtttgataaaaaatgtctaatttctaacctctgagattg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48924300 |
ttaagtaacctatgtgaagtgtgatgtatcgttgcatccttttctgaattgtatgttaggtgtttgat--aaaatgtctaatttctaacctctgagattg |
48924203 |
T |
 |
| Q |
130 |
tcttcaaaacataaa |
144 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
48924202 |
tcttcaaaacataaa |
48924188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University