View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0192_low_9 (Length: 317)
Name: NF0192_low_9
Description: NF0192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0192_low_9 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 99 - 317
Target Start/End: Original strand, 3730696 - 3730916
Alignment:
| Q |
99 |
cattttcatgtttctacaagacaattaaaaatacaaaaagctagttttgttgaaagagtttaaaatgtc--tcttgatattgacaaacctgaatcatttc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3730696 |
cattttcatgtttctacaagacaattaaaaatacaaaaagctagttttgttgaaagagtttaaaatgtcgttcttgatattgacaaacctgaatcatttc |
3730795 |
T |
|
| Q |
197 |
taacaattctgaatttttccaggggccttcatcactcatcaagcaacctccatattcagaacatgtgcaattaccacccaaaaatgttggcaagttaatg |
296 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
3730796 |
taacaattctgaatttttccaggggccttgatcactcatcaagcaacctccatattcagaacatgtgcaattaccacccaaaaatgttggcaagttactg |
3730895 |
T |
|
| Q |
297 |
aaaaattgaacaattagatct |
317 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3730896 |
aaaaattgaacaattagatct |
3730916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 917 times since January 2019
Visitors: 1516