View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0193-INSERTION-3 (Length: 286)
Name: NF0193-INSERTION-3
Description: NF0193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0193-INSERTION-3 |
 |  |
|
[»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 109 - 286
Target Start/End: Original strand, 3607254 - 3607431
Alignment:
Q |
109 |
aattctcataacatttttagcattggttcttccaacaaaagtttgtaaaagaaatatgaaatggttgcctnnnnnnnng--gaaatgtgatccatttgag |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
T |
3607254 |
aattctcataacatttttagcattggttcttccaacaaaagtttgtaaaagaaatatgaaatggttgcctaaaaaaaatatgaaatgt--tccatttgag |
3607351 |
T |
 |
Q |
207 |
ttctcaaaacgatttaccattggagcaaaaatttgagacaattcttataagaacctaatttagttttagcattggagatg |
286 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
3607352 |
ttctcaaaacgatttaccattggagcaaaaatttgagacaattcttataagaacctaattttgttttagcattggagatg |
3607431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 1 - 112
Target Start/End: Original strand, 3607427 - 3607538
Alignment:
Q |
1 |
agatgcttgtcgtaagacttgtaataaattattttcctccatcacaacataccgattagtctttccataagcaaaatttcgtgttaactttttctttaaa |
100 |
Q |
|
|
||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3607427 |
agatgcttgtcgtaagacttgtaataattcattttcctccatcacaacataccgattagtctttccataagcaaaatttcgtgttaactttttctttaaa |
3607526 |
T |
 |
Q |
101 |
taaaaaacaatt |
112 |
Q |
|
|
|||||||||||| |
|
|
T |
3607527 |
taaaaaacaatt |
3607538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University