View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0193_high_14 (Length: 287)
Name: NF0193_high_14
Description: NF0193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0193_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 29 - 252
Target Start/End: Original strand, 5051206 - 5051431
Alignment:
| Q |
29 |
ataagtgaatgtctaaacactataagtttgatcatgtaccaaacaagattaactctgccaaacttatcatttcgaattgaaaaacaaaaagtgaatacca |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5051206 |
ataagtgaatgtctaaacactataagtttgatcatgtaccaaacaagattaactctgccaaacttatcatttcgaattcaaaaacaaaaagtgaatacca |
5051305 |
T |
|
| Q |
129 |
acatcatattggaagctttattttatttcgacaactac--tttcacttaattaactcttaacggaaatacttaatagatcacaattagttactaataatc |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5051306 |
acatcatattggaagctttattttatttcgccaactactttttcacttaattaactcttaacggaaatacttaatagatcacaattagttactaacaatc |
5051405 |
T |
|
| Q |
227 |
agtgatcaagttagtgaaatcataat |
252 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
5051406 |
agtgatcaagttagtgaaatcataat |
5051431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 250 - 278
Target Start/End: Original strand, 5051443 - 5051471
Alignment:
| Q |
250 |
aatttagtatgcgtggattcgtcctatga |
278 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5051443 |
aatttagtatgcgtggattcgtcctatga |
5051471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1204 times since January 2019
Visitors: 1528