View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0193_high_22 (Length: 257)

Name: NF0193_high_22
Description: NF0193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0193_high_22
NF0193_high_22
[»] chr8 (1 HSPs)
chr8 (30-257)||(18600559-18600786)


Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 30 - 257
Target Start/End: Original strand, 18600559 - 18600786
Alignment:
30 acaagaaagtcccaccaactaagcaacccatgaagaacatggaagctggaaggcctgtgatgatagagctctcacactgcatggcccattcagatatgat 129  Q
    ||||||||  |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
18600559 acaagaaaagcccaccaactaagcaacccatgaagaacatggaagctggaagacctgtgatgatagagctctcacactgcatggcccattcagatatgat 18600658  T
130 ggaggcttgtggtggcccatcccaagcccatgagcctttgggaaacttacacacatcattaaatgatggtgtcgagtagcagccattcaaaatgtcaatg 229  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18600659 ggaggcctgtggtggcccatcccaagcccatgagcctttgggaaacttacacacatcattaaatgatggtgtcgagtagcagccattcaaaatgtcaatg 18600758  T
230 ttttcaccggtgcagtgccatgatggaa 257  Q
    ||||||||||||||||||||||||||||    
18600759 ttttcaccggtgcagtgccatgatggaa 18600786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University