View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0193_high_24 (Length: 252)
Name: NF0193_high_24
Description: NF0193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0193_high_24 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 30 - 252
Target Start/End: Original strand, 6553606 - 6553828
Alignment:
| Q |
30 |
caaacatcaatctccaaacaccggaaagaatagataacatgcagttttgtcaagttaactccaatggacccttcatagattttgataaatgtggtaagtc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6553606 |
caaacatcaatctccaaacaccggaaagaatagataacatgcagttttgtcaagttaactccaatggacccttcatagattttgataaatgtggtaagtc |
6553705 |
T |
 |
| Q |
130 |
aacaaaagtgcaattgattatttcctgtctaagtgatttgtttttcgtttaattcatatacatcgtcagtgcaaagnnnnnnnnataccatcaatcaatc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6553706 |
aacaaaagtgcaattgattatttcctgtctaagtgatttgtttttcgtttaattcatatacatcgtcagtgcaaagttttttttataccatcaatcaatc |
6553805 |
T |
 |
| Q |
230 |
ataatggtcagagatcttgcctt |
252 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
6553806 |
ataatggtcagagatcttgcctt |
6553828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 33 - 131
Target Start/End: Complemental strand, 49059100 - 49059002
Alignment:
| Q |
33 |
acatcaatctccaaacaccggaaagaatagataacatgcagttttgtcaagttaactccaatggacccttcatagattttgataaatgtggtaagtcaa |
131 |
Q |
| |
|
|||| |||||| |||||| ||| ||||||||||| ||||||||||||||||| |||||||||||||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
49059100 |
acattaatctcaaaacacaggatagaatagataaaatgcagttttgtcaagtaaactccaatggacccttcatggattttgatgaatgtggtatgtcaa |
49059002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University