View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0193_high_27 (Length: 251)
Name: NF0193_high_27
Description: NF0193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0193_high_27 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 30 - 251
Target Start/End: Complemental strand, 32169181 - 32168963
Alignment:
| Q |
30 |
gaaagcatttgtggtaggataaaggtttcaatgctttaggatattttagtttgagtgtctctttcaggacaactttagatgattttaatggggactccgt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32169181 |
gaaagcatttgtggtaggataaaggtttcaatgctttaggatattttagtttgagtgtctctttcaggacaactttagatgattttaatggggactccgt |
32169082 |
T |
 |
| Q |
130 |
tctcaataaagctattatggtaagagaaaagaactagtaagctttatatagagagaagnnnnnnnnnngtgttgtcaattgatgaataatgtctcgattg |
229 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32169081 |
tctaaataaagctattatggtaagagaaaagaactagtaaggtttatatagagaga---gaaaaaaaagtgttgtcaattgatgaataatgtctcgattg |
32168985 |
T |
 |
| Q |
230 |
tgcttatacaaatattacatcc |
251 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32168984 |
tgcttatacaaatattacatcc |
32168963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University