View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0193_high_32 (Length: 241)

Name: NF0193_high_32
Description: NF0193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0193_high_32
NF0193_high_32
[»] chr7 (2 HSPs)
chr7 (157-221)||(5347437-5347501)
chr7 (63-95)||(5347343-5347375)


Alignment Details
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 157 - 221
Target Start/End: Original strand, 5347437 - 5347501
Alignment:
157 atggaagctactgtgagtaattctgaaacttgtttccatgttgaagatgaagattttgatgatgt 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5347437 atggaagctactgtgagtaattctgaaacttgtttccatgttgaagatgaagattttgatgatgt 5347501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 95
Target Start/End: Original strand, 5347343 - 5347375
Alignment:
63 aagtgatgggtttgagaggattttgtggattag 95  Q
    |||||||||||||||||||||||||||||||||    
5347343 aagtgatgggtttgagaggattttgtggattag 5347375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1098 times since January 2019
Visitors: 1523