View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0193_low_11 (Length: 347)

Name: NF0193_low_11
Description: NF0193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0193_low_11
NF0193_low_11
[»] chr7 (2 HSPs)
chr7 (115-337)||(3615650-3615872)
chr7 (1-94)||(3615561-3615654)
[»] chr3 (2 HSPs)
chr3 (9-108)||(34732060-34732160)
chr3 (56-84)||(47820326-47820354)
[»] chr4 (1 HSPs)
chr4 (41-84)||(52005161-52005204)


Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 115 - 337
Target Start/End: Original strand, 3615650 - 3615872
Alignment:
115 tccttgtataggggatttttagacagcagctggggtatattttgggcagttttctcggctgttaatgctggtgtttgcagcttccgctgtcatgcccggc 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
3615650 tccttgtataggggatttttagacagcagctggggtatattttgggcagttttctcggctgttaatgctggtgtgtgcagcttccgctgtcatgcccggc 3615749  T
215 aaaaccaacagtcgttggtttttatctctgtttttgcgcctttgtcgcttgctttctggtatattggcttttgcttttgtaggatcatctgttgttttta 314  Q
    ||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
3615750 aaaaccagcagtcgttggtttttatctctgtttttgcgcctttgtcacttgctttctggtatattggcttttgcttttgtaggatcatctgttgttttta 3615849  T
315 ttttcttgcctttgtcgtctgtg 337  Q
    ||| |||||||||||||||||||    
3615850 tttccttgcctttgtcgtctgtg 3615872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 3615561 - 3615654
Alignment:
1 ttaagactttgtcttggtgttgggcttaaataggtctcgaattgcatcttgcctattctatgagtggtgttggaatccaagggattgcttcctt 94  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||    
3615561 ttaagactttgtcttggtgttgggcttaaataggtctcgaattgcatcttacctattctatgagtggtgtgggaatccaagggattgcttcctt 3615654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 9 - 108
Target Start/End: Original strand, 34732060 - 34732160
Alignment:
9 ttgtcttggtgttgggc-ttaaataggtctcgaattgcatcttgcctattctatgagtggtgttggaatccaagggattgcttccttaggaggcgttgat 107  Q
    ||||||||||||||||| |||||||||   || ||| |||||||||||| ||| |||||||||||||| |||||||| ||||| ||||||||||||||||    
34732060 ttgtcttggtgttgggcgttaaataggctccgtatttcatcttgcctatactacgagtggtgttggaaaccaagggagtgcttacttaggaggcgttgat 34732159  T
108 t 108  Q
    |    
34732160 t 34732160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 56 - 84
Target Start/End: Original strand, 47820326 - 47820354
Alignment:
56 ttctatgagtggtgttggaatccaaggga 84  Q
    |||||||||||||||||||||||||||||    
47820326 ttctatgagtggtgttggaatccaaggga 47820354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 41 - 84
Target Start/End: Complemental strand, 52005204 - 52005161
Alignment:
41 attgcatcttgcctattctatgagtggtgttggaatccaaggga 84  Q
    ||||| ||||||||||||||||||||||||||||||||| ||||    
52005204 attgcgtcttgcctattctatgagtggtgttggaatccacggga 52005161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University