View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0193_low_19 (Length: 308)

Name: NF0193_low_19
Description: NF0193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0193_low_19
NF0193_low_19
[»] chr5 (1 HSPs)
chr5 (86-209)||(23145629-23145752)


Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 86 - 209
Target Start/End: Original strand, 23145629 - 23145752
Alignment:
86 cagtcttctgcattcagcaggtggtttcgagctaggcagtgtgattttggactgtggcggtgttttggagcatctttgggcctttgatatcttaggtttt 185  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23145629 cagtcttctgcattcagcaggtggtttcgagttaggcagtgtgattttggactgtggcggtgttttggagcatctttgggcctttgatatcttaggtttt 23145728  T
186 ttgtctgagatgttagtttgggtg 209  Q
    ||| ||||||||||||||| ||||    
23145729 ttggctgagatgttagttttggtg 23145752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University