View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0193_low_19 (Length: 308)
Name: NF0193_low_19
Description: NF0193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0193_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 86 - 209
Target Start/End: Original strand, 23145629 - 23145752
Alignment:
Q |
86 |
cagtcttctgcattcagcaggtggtttcgagctaggcagtgtgattttggactgtggcggtgttttggagcatctttgggcctttgatatcttaggtttt |
185 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23145629 |
cagtcttctgcattcagcaggtggtttcgagttaggcagtgtgattttggactgtggcggtgttttggagcatctttgggcctttgatatcttaggtttt |
23145728 |
T |
 |
Q |
186 |
ttgtctgagatgttagtttgggtg |
209 |
Q |
|
|
||| ||||||||||||||| |||| |
|
|
T |
23145729 |
ttggctgagatgttagttttggtg |
23145752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University